Gene Tools, LLC
- Home
- Companies
- Gene Tools, LLC
- Products
- Gene Tools - Clawed Frog Beta Catenin ...
Gene Tools - Clawed Frog Beta Catenin Positive Control Oligo
FromGene Tools, LLC
This carboxyfluoresceinated Morpholino oligo targets the Xenopus laevis Beta Catenin gene. This oligo acts as a positive control for knockdown of Beta Catenin in frog embryos.
- Short Description : Xenopus laevis Beta Catenin antisense oligo
- Oligo sequence : TTTCAACCGTTTCCAAAGAACCAGG
- Size and End-Modifications : 100 nmol with 3` Fluorescein
- Molar Absorptivity : 262740.00
- Molecular Weight : 8901.00
- Harmonizing Code : 2934999000
- Shipping Commodity Description : Synthetic non toxic reagent
- Country of Origin : US
- Physical Weight : 0.001 g
- Restricted Item : Public
- SKU: PCO-BetaCatenin-100-F
