Gene Tools, LLC
  1. Companies
  2. Gene Tools, LLC
  3. Products
  4. Gene Tools - Green Fluorescent Protein ...

Gene ToolsGreen Fluorescent Protein Positive Control

SHARE

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

  • Short Description : Translation blocker for GFP target
  • Oligo sequence : ACAGCTCCTCGCCCTTGCTCACCAT
  • Size and End-Modifications : 100 nmol
  • Molar Absorptivity : 246420.00
  • Molecular Weight : 8275.00
  • Harmonizing Code : 2934999000
  • Shipping Commodity Description : Synthetic non toxic reagent
  • Country of Origin : US
  • Physical Weight : 0.001 g
  • Restricted Item : Public
  • SKU: PCO-GFPControl-100