Gene Tools, LLC
  1. Companies
  2. Gene Tools, LLC
  3. Products
  4. Gene Tools - Vivo-Morpholino GFP ...

Gene ToolsVivo-Morpholino GFP Positive Control

SHARE

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

  • Short Description ; Translation blocker for GFP target (Vivo-Morpholino)
  • Oligo sequence : ACAGCTCCTCGCCCTTGCTCACCAT
  • Size and End-Modifications : 100 nmol
  • Molar Absorptivity : 246420.00
  • Molecular Weight : 10085.00
  • Harmonizing Code : 2934999000 : Shipping Commodity Description
  • Synthetic non toxic reagent : Country of Origin  :  US
  • Physical Weight : 0.001 g
  • Restricted Item : Public
  • SKU: PCO-VivoGFPControl-100