Gene Tools, LLC

Zebrafish Chordin Positive Control Oligo

SHARE

This carboxyfluoresceinated Morpholino oligo targets the Danio rerio Chordin gene. This oligo acts as a positive control for knockdown of Chordin in zebrafish embryos.

  • Short Description : Danio rerio Chordin positive control oligo
  • Oligo sequence : ATCCACAGCAGCCCCTCCATCATCC
  • Size and End-Modifications : 100 nmol with 3` Fluorescein
  • Molar Absorptivity : 250880.00
  • Molecular Weight : 8742.00
  • Harmonizing Code : 2934999000
  • Shipping Commodity Description : Synthetic non toxic reagent
  • Country of Origin : US
  • Physical Weight : 0.001 g
  • Restricted Item : Public
  • SKU: PCO-ZebrafishChordin-100-F