Gene Tools, LLC
- Home
- Companies
- Gene Tools, LLC
- Products
- Zebrafish Chordin Positive Control ...
Zebrafish Chordin Positive Control Oligo
FromGene Tools, LLC
This carboxyfluoresceinated Morpholino oligo targets the Danio rerio Chordin gene. This oligo acts as a positive control for knockdown of Chordin in zebrafish embryos.
- Short Description : Danio rerio Chordin positive control oligo
- Oligo sequence : ATCCACAGCAGCCCCTCCATCATCC
- Size and End-Modifications : 100 nmol with 3` Fluorescein
- Molar Absorptivity : 250880.00
- Molecular Weight : 8742.00
- Harmonizing Code : 2934999000
- Shipping Commodity Description : Synthetic non toxic reagent
- Country of Origin : US
- Physical Weight : 0.001 g
- Restricted Item : Public
- SKU: PCO-ZebrafishChordin-100-F