Gene Tools, LLC
  1. Companies
  2. Gene Tools, LLC
  3. Products
  4. Gene Tools - Model p53 - Zebrafish ...

Gene ToolsModel p53 -Zebrafish Oligo

SHARE

This is a Morpholino oligo targeting zebrafish p53, reported to suppress apoptotic effects induced by some Morpholinos (Robu et al. 2007, PLoS Genetics).

Most popular related searches

Short Description: Danio rerio apoptosis suppression oligo
Oligo sequence: GCGCCATTGCTTTGCAAGAATTG
Size and End-Modifications: 100 nmol

Molar Absorptivity: 236990.00
Molecular Weight: 7804.00
Harmonizing Code: 2934999000
Shipping Commodity Description: Synthetic non toxic reagent
Country of Origin: US
Physical Weight: 0.001 g
Restricted Item: Public
SKU: PCO-ZebrafishP53-100