Influenza A virus replication has a stronger dependency on Raf/MEK/ERK signaling pathway activity than SARS-CoV-2

The recent COVID-19 pandemic again highlighted the urgent need for broad-spectrum antivirals, both for therapeutic use in acute viral infection and for pandemic preparedness in general. The targeting of host cell factors hijacked by viruses during their replication cycle presents one possible strategy for development of broad-spectrum antivirals. By inhibiting the Raf/MEK/ERK signaling pathway, a central kinase cascade of eukaryotic cells, which is being exploited by numerous viruses of different virus phyla, the small-molecule MEK inhibitor zapnometinib has the potential to address this need. We here performed a side-by-side comparison of the antiviral efficacy of zapnometinib against IAV and SARS-CoV-2 to determine the concentration leading to 50% of its effect on the virus (EC₅₀) and the concentration leading to 50% reduction of ERK phosphorylation (IC₅₀) in a comparable manner, using the same experimental conditions. Our results show that the EC₅₀ value and IC₅₀ value of zapnometinib are indeed lower for IAV compared to SARS-CoV-2 using one representative strain for each. The results suggest that IAV’s replication has a stronger dependency on an active Raf/MEK/ERK pathway and, thus, that IAV is more susceptible to treatment with zapnometinib than SARS-CoV-2. With zapnometinib’s favorable outcome in a recent phase II clinical trial in hospitalized COVID-19 patients, the present results are even more promising for an upcoming phase II clinical trial in severe influenza virus infection.

1 Introduction

As of today, virus infections, especially those with pandemic potential, still pose a major threat to humans as broad-spectrum antiviral therapies to treat acute infection are still missing. Present approaches to control virus infection are highly specific and mainly include preventive measures such as vaccination or treatment of acute infections with direct-acting antivirals. Both approaches are compromised by the fast appearance of new virus variants escaping the preventive and therapeutic measures. The coronavirus disease 2019 (COVID-19) pandemic has clearly demonstrated the need for broad-spectrum antiviral drugs that are effective in treating more than just one specific virus variant, virus species, or phylum. One strategy to develop long-lasting broad-spectrum antiviral drugs includes targeting host cell proteins that are used by a broad number of viruses to enable their replication (Schor and Einav, 2018; Lesch et al., 2019; Gutierrez-Chamorro et al., 2021; Meineke et al., 2022; Wild et al., 2022). An advantage of this strategy is that host cell targets are not affected by the fast mutation rate of the virus and are therefore expected not to be prone to resistance development. On the other hand, host cell targeting drugs need to be carefully assessed for potential toxic side effects on the host. The rapid accelerated fibrosarcoma/mitogen-activated protein kinase kinase/extracellular signal-regulated kinase (Raf/MEK/ERK) signaling pathway represents one of those targets for broad-spectrum antiviral drug development as it is exploited by many viruses during their replication cycle, e.g., coronaviruses, Ebola virus, hepatitis C virus, respiratory syncytial virus, yellow fever virus, Borna disease virus, and influenza virus (Planz et al., 2001; Pleschka et al., 2001; Zampieri et al., 2007; Pleschka, 2008; Menzel et al., 2012; Albarnaz et al., 2014; Bonjardim, 2017; Preugschas et al., 2019; Schreiber et al., 2020; Meineke et al., 2022; Schreiber et al., 2022). Zapnometinib, a small-molecule inhibitor, targets MEK1/2, the central kinase of the Raf/MEK/ERK pathway, and thereby blocks its downstream activities. Zapnometinib has been developed for the treatment of severe respiratory viral infections with complications of hyperinflammation. The antiviral activity of zapnometinib treatment has been demonstrated for influenza virus infection in vivo (Laure et al., 2020; Koch-Heier et al., 2022) and influenza virus and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection in vitro (Laure et al., 2020; Schreiber et al., 2020; Schreiber et al., 2022). Furthermore, zapnometinib has been shown to be well tolerated in a phase I clinical trial (ClinicalTrials.gov NCT04385420) in healthy volunteers and is considered safe to be used in humans.

Influenza viruses are enveloped, negative-sense, single-stranded RNA viruses that belong to the family of Orthomyxoviridae with influenza A, B, and C virus causing infection in human. Until today, influenza A virus (IAV) poses a great threat to human health having caused several pandemics with high mortality, e.g., the Spanish flu in 1918, the Asian flu in 1957, and the swine flu pandemic in 2009 (Taubenberger and Morens, 2006; Dawood et al., 2012; Viboud et al., 2016). IAV infects epithelial cells by binding with its hemagglutinin (HA) spikes to sialic acid residues on the host cell surface (Couceiro et al., 1993). For successful fusion of the virus envelope with the host cell membrane, the HA precursor protein needs to be cleaved by serine proteases into HA1 and HA2 during replication of the virus. Host cell proteases facilitating this step are, among others, the transmembrane protease, serine 2 (TMPRSS2), the transmembrane protease, serine 4 (TMPRSS4), and the human airway trypsin-like protease (HAT) (Steinhauer, 1999; Böttcher-Friebertshäuser et al., 2010). Following attachment, the virus enters the cell via endocytosis. Unlike most other RNA viruses, replication of influenza viruses takes place in the nucleus (Herz et al., 1981). Later, virus budding and release of new virions occur at the cell membrane (reviewed in Nayak et al., 2004). For IAV, activation of the RAF/MEK/ERK signaling pathway has been shown to occur in an unusual biphasic manner, with a transient activation early in the replication cycle within the first 30 min of infection and a second, more sustained activation phase at 8–10 h post-infection (Pleschka et al., 2001).

SARS-CoV-2, an enveloped, positive-sense single-stranded RNA virus belonging to the family of Coronaviridae, has caused the most recent pandemic with more than 700 million confirmed cases of COVID-19, leading to more than 6 million deaths worldwide (WHO Coronavirus (COVID-19) Dashboard). SARS-CoV-2 can enter host cells by binding to receptors like the angiotensin-converting enzyme 2 (ACE2). For efficient fusion and entry, the SARS-CoV-2 spike protein needs to be cleaved by suitable host cell proteases on the cell surface like TMPRSS2. Another entry route is via endocytosis where endosomal cathepsins can cleave the spike protein to facilitate fusion (Hoffmann et al., 2020). Unlike IAV, SARS-CoV-2 replicates solely in the cytoplasm. Assembly and budding of new virions take place at the endoplasmic reticulum Golgi intermediate compartment (ERGIC) (Scherer et al., 2022). Activation of the Raf/MEK/ERK signaling pathway has been shown to be an early and transient event in the replication cycle and was detected within the first 2 h post-infection in Calu-3 cells (Schreiber et al., 2022). Furthermore, Forsyth et al. found that binding of Spike S1 to the ACE2 receptor leads to activation of the Raf/MEK/ERK signaling pathway and the induction of cytokines (Forsyth et al., 2022). In vivo, the activation of the signaling pathway has been shown in response to infection in a COVID-19 mouse model. MEK inhibition could circumvent this effect (Xie et al., 2022).

With IAV and SARS-CoV-2 both being dependent on active MEK1/2 to sustain their replication, we were interested in a direct comparison of the drug efficacy of zapnometinib. Key figures used to characterize a drug’s efficacy are the IC₅₀ and EC₅₀ concentration. The IC₅₀ value represents the concentration of an inhibitor leading to 50% inhibition of its target and the EC₅₀ the concentration at which 50% of the drug’s effect is obtained. In the case of zapnometinib, the IC₅₀ is the concentration at which 50% of MEK1/2 inhibition is observed. With ERK1/2 being the main substrate of MEK1/2, MEK inhibition is routinely determined by measuring ERK1/2 phosphorylation (Figure 1). Therefore, a reduction of 50% in ERK1/2 phosphorylation corresponds to 50% MEK1/2 inhibition. Nevertheless, cell-type-specific MEK-independent ERK phosphorylation has been reported in human neutrophil granulocytes (Simard et al., 2015). As the intended effect of an antiviral drug is a reduction in viral progeny, the EC₅₀ value represents the zapnometinib concentration leading to a reduction of the virus titer by 50% (Figure 1). EC₅₀ and IC₅₀ are frequently used to compare the efficacy and potency of different drugs. However, a direct comparison can be difficult if these values were determined under different experimental conditions. Depending on a drug’s properties, such as binding to serum proteins, metabolization, temperature sensitivity of binding constants, or the timepoint they were assessed at, these values can change significantly (Caldwell et al., 2012; Pruijssers et al., 2020). For direct-acting antivirals, a direct correlation between the specific virus and the EC₅₀ value can be expected. With zapnometinib targeting a host cell protein instead, the question arose, whether the EC₅₀ value would be independent of the infecting virus under the same experimental conditions, as long as the infecting virus depends on an active Raf/MEK/ERK signaling pathway for its replication. Alternatively, different viruses may need different levels of MEK1/2 activity to sustain their replication and would therefore differ in their EC₅₀ value. For development of a potential broad-spectrum antiviral, this information is especially important to predict the antiviral potential of the drug for other viruses and new arising virus species. In the present study, we therefore investigated if there is a difference in the dependency of SARS-CoV-2 and IAV on the Raf/MEK/ERK signaling pathway and subsequently on their susceptibility to zapnometinib treatment.

2 Methods2.1 Viruses and cells

SARS-CoV-2 (B.1., Isolate “FI”, hCoV-19/Germany/FI1103201/2020) was taken from the strain repository of the Institute of Virology (IVM), Westfaelische Wilhelms-University Muenster, Germany (Schreiber et al., 2022), and passaged on Vero E6 cells (Cercopithecus aethiops, kidney epithelial cells) in a BSL3 laboratory. Influenza A virus, strain: A/Puerto Rico/8/1934 (H1N1) was obtained from Friedrich-Loeffler-Institute, Federal Research Centre for Virus Diseases of Animals, Tuebingen, Germany, and passaged on MDCK II cells in a BSL 2 laboratory. Calu-3 cells (Homo sapiens lung epithelial cells) and MDCK II cells (Canis familiaris kidney cells) were obtained from the American Type Culture Collection (ATCC). Caco-2 cells (Homo sapiens colon epithelial cells) were provided by the Institute for Medical Virology and Epidemiology of Viral Disease, Department of Molecular Virology, University Hospital Tuebingen, Germany. Cells were maintained in Iscove Modified Dulbecco Media (IMDM) (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (Capricorn Scientific GmbH, Ebsdorfergrund, Germany) and 1% penicillin–streptomycin (Sigma Aldrich, St. Louis, MO, USA) at 37°C, 5% CO₂ in a humidified incubator.

2.2 Inhibitors

The MEK1/2 inhibitor Zapnometinib (PD184264, ATR-002), [2-(2-chloro-4-iodophenylamino)-N-3,4-difluoro benzoic acid], was synthesized at ChemCon, Freiburg, Germany, and provided by Atriva Therapeutics, Tuebingen, Germany.

2.3 Virus yield reduction assay

Calu-3 and Caco-2 cells were seeded in 24-well plates (Greiner Bio-One GmbH, Frickenhausen, Germany) and grown to 90% confluence. The cells were washed once with infection medium [IMDM supplemented with 0.2% bovine serum albumin (BSA) (Carl Roth GmbH + Co. KG, Karlsruhe, Germany) and 1% penicillin–streptomycin] prior to infection with a multiplicity of infection (MOI) of 0.01 of IAV PR8 or SARS-CoV-2 for 1 h in 200 µL of infection medium per well. Afterwards, the virus inoculum was removed completely, and the cells were washed once with infection medium and then treated with 1 mL per well of different concentrations of zapnometinib in infection medium with 1% dimethyl sulfoxide (DMSO) (Merck Millipore, Burlington, MA, USA) for 24 h at 37°C, 5% CO₂. Supernatants were harvested and stored at −80°C for subsequent determination of virus titer and EC₅₀ value. Cell lysates were prepared as described in the “Preparation of cell lysates and WES™ analysis” section for WES™ analysis.

2.4 Virus titer determination

The viral titers of IAV and SARS-CoV-2 viruses were determined using a real-time one-step multiplex RT-qPCR method. Briefly, viral nucleic acid extraction was performed using a QIAamp Viral RNA Mini Kit (Qiagen, Venlo, Netherlands) according to the manufacturer’s instructions. A TaqMan-based RT-qPCR assay was carried out using a QuantiNova Pathogen kit (Qiagen, Venlo, Netherlands) with specific primers targeting the SARS-CoV-2 N gene (2019-CoV2-N1F: AACACAAGCTTTCGGCAGAC, 2019-CoV2-N1R: ATTCCGAAGAACGCTGAAGC, 2019-CoV2-N1P [6FAM]: ACATTGGCCGCAAATTGCACAA [BHQ1]) and M gene for IAV according to the WHO guidelines. The viral genome copies per mL (gc/mL) were determined based on a standard curve prepared with 10-fold serial dilutions of the target gene. For quality control, nuclease-free water was included in each set of extractions as a negative control to monitor any possible cross-contamination. Moreover, an artificial exogenous QuantiNova RNA internal control (Qiagen, Venlo, Netherlands) was included during the nucleic acid purification to monitor the RNA purification efficiency and the RT-PCR amplification. A Rotor-Gene Q™ Real-Time PCR detection system (Qiagen, Venlo, Netherlands) was used for amplification, and the data were analyzed using Q-Rex software (Qiagen, Venlo, Netherlands).

2.5 EC₅₀ determination

For EC₅₀ determination, a virus yield reduction assay was performed. The virus titer in the cell culture supernatant was determined and normalized to the solvent control. The EC₅₀ value was determined using the “log(inhibitor) vs. normalized response - Variable slope” equation in GraphPad Prism version 9.4.0.

2.6 Preparation of cell lysates and WES™ analysis

Cells were lysed using cold modified RIPA buffer [0.24% (w/v) tris base (Sigma-Aldrich, St. Louis, Missouri, USA), 0.88% (w/v) NaCl (Carl Roth, Karlsruhe, Germany), 0.2% (v/v) 500 mM ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, St. Louis, Missouri, USA), 1% (v/v) Triton X-100 (Sigma-Aldrich, St. Louis, Missouri, USA), 0.5% (w/v) sodium deoxycholate (Sigma-Aldrich, St. Louis, Missouri, USA), 0.1% (w/v) sodium dodecyl sulfate (SDS) (Carl Roth, Karlsruhe, Germany), 10% (v/v) glycerol (Carl Roth, Karlsruhe, Germany), 0.05% phenylmethylsulfonyl fluoride (PMSF) (Carl Roth, Karlsruhe, Germany), 0.01% Benzonase® Nuclease (Sigma-Aldrich, St. Louis, Missouri, USA), protease inhibitor cocktail (Roche, Basel, Switzerland), and phosphatase inhibitor cocktail (Roche, Basel, Switzerland) in water]. Determination of the protein concentration was performed using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instructions. The samples were analyzed by Wes™ using a total protein concentration of 0.25–0.5 µg/µL for each sample, the Jess/Wes Separation kit (12–230 kDa), primary antibodies against ERK1/2, p44/42 MAPK (137F5) Rabbit mAb (Cell Signaling Technology, Danvers, MA, USA, Cat. No. 4695S) and phospho-ERK1/2 (pERK1/2), Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E), XP® Rabbit mAb (Cell Signaling Technology, Danvers, MA, USA, Cat. no. 4370S) in a 1:50 dilution, anti-Influenza A virus Nucleoprotein (NP) antibody (rabbit MAb) (Sino Biological, Beijing, China Cat.no 40208-R010) in a 1:150 dilution, SARS-CoV-2 nucleocapsid protein antibody (ProSci Inc., Poway, CA, USA, Cat. no. 35-580) in a 1:100 dilution, the anti-goat, anti-rabbit, and anti-mouse detection modules, and the EZ Standard Pack 1 (12–230 kDa), according to the manufacturer’s instructions. Analysis of the obtained data was performed using the Compass for SW 4.1.0 software, Microsoft Excel, and the GraphPad Prism 9.2.0 software. Ratios were calculated from the area under the curve of the respective detected signals.

2.7 IC₅₀ determination

For determination of the IC₅₀ value in the absence of viral infection, the cells were seeded in 24-well plates and incubated at 37°C, 5% CO₂ until confluent. Twenty-four hours before the experiment, the growth medium was exchanged to medium with respective FBS or BSA concentration. Then, cells were stimulated by the addition of tumor necrosis factor alpha (TNF-α) (Sigma-Aldrich, St. Louis, Missouri, USA) for 30 min at 37°C, 5% CO₂, followed by treatment with different zapnometinib concentrations and a DMSO (solvent) control for 1 h. For determination of the IC₅₀ value in cells infected with IAV PR8 or SARS-CoV-2, cells were infected with the respective virus and treated with zapnometinib for 24 h as described in the “Virus yield reduction assay” section. After incubation, cell lysates were prepared, and the samples were analyzed by WES™ as described in the “Preparation of cell lysates and WES™ analysis” section. The pERK/ERK ratio was calculated and normalized to the solvent control. IC₅₀ values were determined using the “log(inhibitor) vs. response -Variable slope (four parameters)” equation in GraphPad Prism version 9.4.0.

2.8 CC₅₀ determination

Per well, 2.5 × 10⁴ Caco-2 cells or 4 × 10⁴ Calu-3 cells were seeded in 96-well plates (Greiner Bio-One, Kremsmünster, Austria) and incubated for 24 h at 37°C, 5% CO₂. Cell viability was assessed using a WST-1 assay according to the manufacturer’s recommendations (Roche, Basel, Switzerland). For reference, cell viability was assessed at 0 h and after 24 h of treatment with different concentrations of zapnometinib in medium containing 1% DMSO. The measured cell viability was normalized to the 0-h control. The CC₅₀ value was determined using the “Sigmoidal, 4PL, X is log(concentration)” equation in GraphPad Prism.

2.9 Flow cytometry analysis

For flow cytometry analysis, 6 × 10⁵ Caco-2 cells were seeded per well in six-well plates (Greiner Bio-One, Kremsmünster, Austria) and incubated for 24 h at 37°C, 5% CO₂. Treatment with zapnometinib or a solvent control (1% DMSO) in medium containing 0.2% BSA was applied for 24 h. A single-cell solution was prepared using TrypLE reagent (Thermo Fisher Scientific, Waltham, MA, USA). Prior to staining, cells were treated with an FcR blocking reagent (Miltenyi Biotec, Bergisch Gladbach, Germany) for 10 min at 4°C. The cells were then stained with either a PE Mouse IgG1Isotype control antibody (BioLegend, San Diego, CA, USA) or a PE anti-human TMPRSS2 Antibody (BioLegend, San Diego, CA, USA), followed by a live-dead staining using the LIVE/DEAD™ Fixable Far Red Dead Cell Stain Kit (Thermo Fisher Scientific, Waltham, MA, USA). Cells were analyzed using the BD FACSCanto II flow cytometer (Becton Dickinson, Franklin Lakes, New Jersey, USA) and the FlowJo software (Becton Dickinson, Franklin Lakes, New Jersey, USA).

2.10 Immunofluorescence analysis

Caco-2 cells were seeded on glass cover slips in 24-well plates in IMDM medium containing 10% FBS and 1% penicillin/streptomycin and grown for 24 h at 37°C, 5% CO₂. The next day, the cells were washed once with infection medium prior to infection with MOI 4 of SARS-CoV-2 or IAV PR8 for 1 h in infection medium per well. Afterwards, the virus inoculum was removed completely, and the cells were washed once with infection medium and treated with 1 mL per well with either different concentrations of zapnometinib or solvent control (1% DMSO) in infection medium for 10 h at 37°C, 5% CO₂. Wells were washed with PBS and fixed with 4% paraformaldehyde (PFA) (Merck Millipore, Burlington, MA, USA) in PBS for 10 min at room temperature prior to permeabilization by the addition of 1 mL of 0.1% Triton X-100 (Merck Millipore, Burlington, MA, USA) in PBS per well for 5 min. Cells were blocked with 1% BSA in PBS for 1 h at room temperature before incubation with 200 µL of the primary antibody [Anti-SARS-CoV-2 nucleocapsid protein antibody (1:400) (ProSci Inc., Poway, CA, USA, Cat. no. 35-580) or Mouse anti-Influenza A virus Nucleoprotein (NP) antibody (1:500) (Bio-Rad Laboratories, Inc., Hercules, CA, USA, Cat No. MCA 400)] in 1% BSA in PBS overnight. The next day, cells were incubated with the secondary antibody [Alexa Fluor™ 488 goat anti-mouse IgG (1:1,000) (Thermo Fisher Scientific, Waltham, MA, USA)] in 1% BSA in PBS for 45 min at room temperature. Glass cover slips were removed from the wells and mounted on microscope slides using Roti^® mount FluorCare DAPI (Carl Roth GmbH + Co. KG, Karlsruhe, Germany). Slides were let dry at 4°C in the dark. Pictures were taken using a confocal laser scanning microscope with immersion oil and a 40× objective lens (LSM800, Zeiss, Oberkochen, Germany) and the Zen 3.3 software (Zeiss, Oberkochen, Germany).

3 Results3.1 SARS-CoV-2 is susceptible to zapnometinib treatment

When the SARS-CoV-2 pandemic started in 2019, it was immediately tested if the replication of the virus was susceptible to treatment with the MEK1/2 inhibitor zapnometinib. Therefore, a virus yield reduction assay was performed on Caco-2 cells in medium containing 5% FBS. We found a concentration-dependent reduction of the virus titer for treatment with zapnometinib (Figures 2A, B). Compared to the solvent control, the virus titer was significantly reduced by zapnometinib treatment with 100 µM (reduction >99%), 75 µM (reduction >94%), 50 µM (reduction >60%), and 25 µM (reduction >39%). No significant reduction of the virus titer was achieved with treatment with 12.5 µM and 6.25 µM zapnometinib (Figure 2B). To calculate the EC₅₀ value of zapnometinib, the measured virus titer in the different treatment conditions was normalized to the solvent control. The EC₅₀ value of zapnometinib against SARS-CoV-2 was found to be 34.17 µM (Figure 2C), which is in line with the result obtained by other laboratories, e.g., 31.33 µM (SARS-CoV-2 B.1 isolate “FI”) by Schreiber and colleagues (Schreiber et al., 2022). In contrast to the previously determined EC₅₀ values for IAV and influenza B virus (IBV) [6.36 µM (IAV RB1), 4.50 µM (IAV Fukui), and 4.19 µM (IBV Lee)] by Laure and colleagues (Laure et al., 2020), the EC₅₀ value determined here for zapnometinib against SARS-CoV-2 is higher. We therefore wanted to investigate if this indicates that influenza virus is more susceptible to treatment with zapnometinib than SARS-CoV-2.