
Gene Tools, LLC
Gene Tools - Vivo-Morpholino Standard Control Oligo
FromGene Tools, LLC
Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.
Short Description: Negative Vivo-Morpholino control oligo
Oligo sequence: CCTCTTACCTCAGTTACAATTTATA
Size and End-Modifications: 100 nmol
Molar Absorptivity: 259160.00
Molecular Weight: 10138.00
Harmonizing Code: 2934999000
Shipping Commodity Description: Synthetic non toxic reagent
Country of Origin: US
Physical Weight: 0.001 g
Restricted Item: Public
SKU: PCO-VivoStandardControl-100